circad | circRNAs associated with diseases

hsa_circ_0004018
Gene	SMYD4	Organism	Human
Genome Locus	chr17:1703150-1704318:-	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	28938566
Experimental Method
Sample Type	Tissues	Comparison	liver tissues were collected from 55 cases of chronic hepatitis patients
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCAACCTTTTGCCCCACACT Reverse AAGACACGTCTGTGTGTTGT	Statistics	Fold Change : Upregulated,294.86 pvalue : p=0.00000047164
Citation
Fu, L, Yao, T, Chen, Q, Mo, X, Hu, Y, Guo, J (2017). Screening differential circular RNA expression profiles reveals hsa_circ_0004018 is associated with hepatocellular carcinoma. Oncotarget, 8, 35:58405-58416.